Stem-loop sequence bmo-mir-2758

AccessionMI0012312 (change log)
DescriptionBombyx mori miR-2758 stem-loop
Literature search

1 open access papers mention bmo-mir-2758
(1 sentences)

Stem-loop
   --  uu    a                   ua  cagg 
5'   ag  uaga gacuugguagaacacguag  ag    u
     ||  |||| |||||||||||||||||||  ||     
3'   uu  aucu uugaaccaucuugugcguc  uc    g
   gg  gg    a                   cc  uaag 
Get sequence
Deep sequencing
9260 reads, 1.7e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582035.1: 2816104-2816179 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2758
bmo-mir-2758NW_004582035.1: 2816104-2816179 [+]
bmo-mir-7NW_004582035.1: 2817062-2817146 [+]
Database links

Mature sequence bmo-miR-2758-5p

Accession MIMAT0013629
Previous IDsbmo-miR-2758
Sequence

11 - 

acuugguagaacacguaguaag

 - 32

Get sequence
Deep sequencing9062 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

Mature sequence bmo-miR-2758-3p

Accession MIMAT0013630
Previous IDsbmo-miR-2758*
Sequence

45 - 

cccugcguguucuaccaaguua

 - 66

Get sequence
Deep sequencing198 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).