Stem-loop sequence bmo-mir-745

AccessionMI0012310 (change log)
DescriptionBombyx mori miR-745 stem-loop
Gene family MIPF0001267; mir-745
Stem-loop
   --      g   cg    a    gu       u  uagg 
5'   uaguug uug  gcuc ucgu  ggcaguu gc    u
     |||||| |||  |||| ||||  ||||||| ||    u
3'   gucaac agc  cggg agcg  ccgucga cg    a
   ga      a   aa    a    au       c  uaag 
Get sequence
Deep sequencing
134 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582011.1: 7922325-7922403 [+]
intergenic
Database links

Mature sequence bmo-miR-745-5p

Accession MIMAT0013625
Previous IDsbmo-miR-745*
Sequence

11 - 

cggcucaucguguggcaguuugcu

 - 34

Get sequence
Deep sequencing10 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence bmo-miR-745-3p

Accession MIMAT0013626
Previous IDsbmo-miR-745
Sequence

47 - 

cagcugccuagcgaagggcaacg

 - 69

Get sequence
Deep sequencing124 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).