Stem-loop sequence bmo-mir-2756

AccessionMI0012309
DescriptionBombyx mori miR-2756 stem-loop
Gene family MIPF0001391; mir-2756
Stem-loop
   --     u   c  cc      u   a       cagc 
5'   ucagu gca ac  uguagc gcc aggggcg    u
     ||||| ||| ||  |||||| ||| |||||||    u
3'   aguca cgu ug  acaucg cgg uccccgc    a
   ua     u   a  uu      u   c       cuua 
Get sequence
Deep sequencing
16497 reads, 5.84e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2887: 1318110-1318186 [-]
intergenic

Mature sequence bmo-miR-2756-5p

Accession MIMAT0013623
Previous IDsbmo-miR-2756
Sequence

11 - 

acccuguagcugccaaggggcg

 - 32

Get sequence
Deep sequencing13506 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]

Mature sequence bmo-miR-2756-3p

Accession MIMAT0013624
Previous IDsbmo-miR-2756*
Sequence

46 - 

ccccucggcugcuacauuguau

 - 67

Get sequence
Deep sequencing34 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).