Stem-loop sequence bmo-mir-9d

AccessionMI0012307 (change log)
DescriptionBombyx mori miR-9d stem-loop
Stem-loop
   g       g       ug    uuc    ga     -ug   a 
5'  cucaauu gaguauu  guga   agcu  uguga   aaa c
    ||||||| |||||||  ||||   ||||  |||||   |||  
3'  gaguuga cuuguga  cacu   ucga  auacu   uuu u
   -       g       gu    uaa    -a     uaa   u 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581684.1: 354559-354643 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-9d
bmo-mir-9dNW_004581684.1: 354559-354643 [-]
bmo-mir-2733cNW_004581684.1: 353724-353805 [-]
bmo-mir-2733gNW_004581684.1: 347847-347958 [-]
bmo-mir-2733a-1NW_004581684.1: 347677-347760 [-]
bmo-mir-2851-1NW_004581684.1: 347670-347768 [+]
bmo-mir-2733b-2NW_004581684.1: 347220-347348 [-]
bmo-mir-2733hNW_004581684.1: 347062-347142 [-]
bmo-mir-2733b-1NW_004581684.1: 346939-347018 [-]
bmo-mir-2733a-3NW_004581684.1: 346598-346745 [-]
bmo-mir-2851-2NW_004581684.1: 346562-346660 [+]
bmo-mir-2733a-2NW_004581684.1: 346489-346605 [-]
bmo-mir-2733fNW_004581684.1: 346080-346197 [-]
bmo-mir-2733iNW_004581684.1: 344891-344998 [-]
Database links

Mature sequence bmo-miR-9d

Accession MIMAT0013620
Sequence

54 - 

auaaagcuaauucacugagugu

 - 75

Get sequence
Deep sequencing12 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).