Stem-loop sequence bmo-mir-9d

AccessionMI0012307
DescriptionBombyx mori miR-9d stem-loop
Stem-loop
   g       g       ug    uuc    ga     -ug   a 
5'  cucaauu gaguauu  guga   agcu  uguga   aaa c
    ||||||| |||||||  ||||   ||||  |||||   |||  
3'  gaguuga cuuguga  cacu   ucga  auacu   uuu u
   -       g       gu    uaa    -a     uaa   u 
Get sequence
Deep sequencing
8 reads, 2.74 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2176: 353029-353113 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-9d
bmo-mir-9dnscaf2176: 353029-353113 [-]
bmo-mir-2733cnscaf2176: 352194-352275 [-]
bmo-mir-2733gnscaf2176: 346317-346428 [-]
bmo-mir-2733a-1nscaf2176: 346147-346230 [-]
bmo-mir-2851-1nscaf2176: 346140-346238 [+]
bmo-mir-2733b-2nscaf2176: 345690-345818 [-]
bmo-mir-2733hnscaf2176: 345532-345612 [-]
bmo-mir-2733b-1nscaf2176: 345409-345488 [-]
bmo-mir-2733a-3nscaf2176: 345068-345215 [-]
bmo-mir-2851-2nscaf2176: 345032-345130 [+]
bmo-mir-2733a-2nscaf2176: 344959-345075 [-]
bmo-mir-2733fnscaf2176: 344550-344667 [-]
bmo-mir-2733inscaf2176: 343361-343468 [-]

Mature sequence bmo-miR-9d

Accession MIMAT0013620
Sequence

54 - 

auaaagcuaauucacugagugu

 - 75

Get sequence
Deep sequencing7 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).