Stem-loop sequence bmo-mir-2733c

AccessionMI0012306 (change log)
DescriptionBombyx mori miR-2733c stem-loop
Literature search

2 open access papers mention bmo-mir-2733c
(5 sentences)

Stem-loop
   g          u    ug     a  g      u   uguc 
5'  auugucacug cagu  ucacu uc ccagug cag    g
    |||||||||| ||||  ||||| || |||||| |||     
3'  uagcaguggc guua  aguga ag ggucac guc    u
   -          c    gu     g  -      u   uuaa 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581684.1: 353724-353805 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2733c
bmo-mir-9dNW_004581684.1: 354559-354643 [-]
bmo-mir-2733cNW_004581684.1: 353724-353805 [-]
bmo-mir-2733gNW_004581684.1: 347847-347958 [-]
bmo-mir-2733a-1NW_004581684.1: 347677-347760 [-]
bmo-mir-2851-1NW_004581684.1: 347670-347768 [+]
bmo-mir-2733b-2NW_004581684.1: 347220-347348 [-]
bmo-mir-2733hNW_004581684.1: 347062-347142 [-]
bmo-mir-2733b-1NW_004581684.1: 346939-347018 [-]
bmo-mir-2733a-3NW_004581684.1: 346598-346745 [-]
bmo-mir-2851-2NW_004581684.1: 346562-346660 [+]
bmo-mir-2733a-2NW_004581684.1: 346489-346605 [-]
bmo-mir-2733fNW_004581684.1: 346080-346197 [-]
bmo-mir-2733iNW_004581684.1: 344891-344998 [-]
Database links

Mature sequence bmo-miR-2733c

Accession MIMAT0013619
Sequence

51 - 

ucacugggagagugaugauugc

 - 72

Get sequence
Deep sequencing47 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).