Stem-loop sequence bmo-mir-2733d

AccessionMI0012305 (change log)
DescriptionBombyx mori miR-2733d stem-loop
Gene family MIPF0000766; mir-2733
Literature search

1 open access papers mention bmo-mir-2733d
(4 sentences)

Stem-loop
   c        au      a      u a    u    ---  u 
5'  ucucugua  gcaguc ucauac c cagu gaua   ug u
    ||||||||  |||||| |||||| | |||| ||||   || u
3'  agagacau  uguuag aguaug g guca cuau   ac g
   -        gg      a      u g    -    cuu  a 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bmo-miR-2733d

Accession MIMAT0013618
Sequence

51 - 

ucacuggguguaugaagauugu

 - 72

Get sequence
Deep sequencing22 reads, 2 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20089182 "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R BMC Genomics. 11:52(2010).