Stem-loop sequence bmo-mir-2733e-1

AccessionMI0012304 (change log)
DescriptionBombyx mori miR-2733e-1 stem-loop
Gene family MIPF0000766; mir-2733
Literature search

2 open access papers mention bmo-mir-2733e-1
(8 sentences)

   acugucuacaacaaugucucucaac         c  -    u    c    ---   u 
5'                          aauaguuau ac uucc cagu gaca   ugu u
                            ||||||||| || |||| |||| ||||   |||  
3'                          uuaucgaua ug aagg guca cugu   aca u
   ----------------agauagguc         a  u    -    -    cuu   c 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581684.1: 342896-342993 [-]
Clustered miRNAs
< 10kb from bmo-mir-2733e-1
bmo-mir-2733gNW_004581684.1: 347847-347958 [-]
bmo-mir-2733a-1NW_004581684.1: 347677-347760 [-]
bmo-mir-2851-1NW_004581684.1: 347670-347768 [+]
bmo-mir-2733b-2NW_004581684.1: 347220-347348 [-]
bmo-mir-2733hNW_004581684.1: 347062-347142 [-]
bmo-mir-2733b-1NW_004581684.1: 346939-347018 [-]
bmo-mir-2733a-3NW_004581684.1: 346598-346745 [-]
bmo-mir-2851-2NW_004581684.1: 346562-346660 [+]
bmo-mir-2733a-2NW_004581684.1: 346489-346605 [-]
bmo-mir-2733fNW_004581684.1: 346080-346197 [-]
bmo-mir-2733iNW_004581684.1: 344891-344998 [-]
bmo-mir-2733e-1NW_004581684.1: 342896-342993 [-]
bmo-mir-2733e-2NW_004581684.1: 342566-342664 [-]
Database links

Mature sequence bmo-miR-2733e

Accession MIMAT0013617

67 - 


 - 88

Get sequence
Deep sequencing63 reads, 2 experiments
Evidence experimental; Illumina [2]


PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
PMID:20089182 "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R BMC Genomics. 11:52(2010).