Stem-loop sequence bmo-mir-2733e-2

AccessionMI0012303 (change log)
DescriptionBombyx mori miR-2733e-2 stem-loop
Gene family MIPF0000766; mir-2733
Literature search

2 open access papers mention bmo-mir-2733e-2
(5 sentences)

Stem-loop
   uuugcuggacugucuauaaugucuuucaac            -   u    aa    uuc 
5'                               aauagcuauuac uuc ccag  gaca   a
                                 |||||||||||| ||| ||||  ||||   c
3'                               uuaucgauaaug aag gguc  cugu   a
   ---------------------uuaaaaccu            u   -    -a    cuu 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581684.1: 342566-342664 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2733e-2
bmo-mir-2733gNW_004581684.1: 347847-347958 [-]
bmo-mir-2733a-1NW_004581684.1: 347677-347760 [-]
bmo-mir-2851-1NW_004581684.1: 347670-347768 [+]
bmo-mir-2733b-2NW_004581684.1: 347220-347348 [-]
bmo-mir-2733hNW_004581684.1: 347062-347142 [-]
bmo-mir-2733b-1NW_004581684.1: 346939-347018 [-]
bmo-mir-2733a-3NW_004581684.1: 346598-346745 [-]
bmo-mir-2851-2NW_004581684.1: 346562-346660 [+]
bmo-mir-2733a-2NW_004581684.1: 346489-346605 [-]
bmo-mir-2733fNW_004581684.1: 346080-346197 [-]
bmo-mir-2733iNW_004581684.1: 344891-344998 [-]
bmo-mir-2733e-1NW_004581684.1: 342896-342993 [-]
bmo-mir-2733e-2NW_004581684.1: 342566-342664 [-]
Database links

Mature sequence bmo-miR-2733e

Accession MIMAT0013617
Sequence

68 - 

ucacugggaauguaauagcuau

 - 89

Get sequence
Deep sequencing63 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).