Stem-loop sequence bmo-mir-2755

AccessionMI0012302
DescriptionBombyx mori miR-2755 stem-loop
Gene family MIPF0001452; mir-2755
Stem-loop
   -u     -        -    c  ag   a    uuu aa 
5'   uuggu gaagcaag gugg cu  cag gugu   c  c
     ||||| |||||||| |||| ||  ||| ||||   |   
3'   aauca uuuuguuc uacc ga  guc cacg   g  a
   cc     a        a    a  cu   c    uuc aa 
Get sequence
Deep sequencing
28707 reads, 8.99e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2860: 227737-227815 [-]
intergenic

Mature sequence bmo-miR-2755-5p

Accession MIMAT0013615
Previous IDsbmo-miR-2755*
Sequence

11 - 

caagguggccuagcagaguguu

 - 32

Get sequence
Deep sequencing149 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]

Mature sequence bmo-miR-2755-3p

Accession MIMAT0013616
Previous IDsbmo-miR-2755
Sequence

47 - 

cacccugucagaccauacuuguu

 - 69

Get sequence
Deep sequencing26760 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).