Stem-loop sequence bmo-mir-1175

AccessionMI0012300 (change log)
DescriptionBombyx mori miR-1175 stem-loop
Gene family MIPF0000715; mir-1175
Literature search

2 open access papers mention bmo-mir-1175
(2 sentences)

Stem-loop
   -guga   -a      -     -ug   uc   u      uua 
5'      cag  uuaagu ggagg   uga  ucu cacuuu   u
        |||  |||||| |||||   |||  ||| ||||||    
3'      guc  aauuca ccucc   acu  aga gugaaa   g
   gcuag   cc      a     uca   -u   -      uuu 
Get sequence
Deep sequencing
1317 reads, 167 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581697.1: 1535938-1536019 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-1175
bmo-mir-750NW_004581697.1: 1536089-1536167 [-]
bmo-mir-1175NW_004581697.1: 1535938-1536019 [-]
Database links

Mature sequence bmo-miR-1175-5p

Accession MIMAT0013612
Sequence

11 - 

aaguggaggugugaucucuuca

 - 32

Get sequence
Deep sequencing1222 reads, 2 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

Mature sequence bmo-miR-1175-3p

Accession MIMAT0013613
Sequence

49 - 

ugagauucaacuccuccaacuuaa

 - 72

Get sequence
Deep sequencing95 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).