Stem-loop sequence bmo-mir-279c

AccessionMI0012299 (change log)
DescriptionBombyx mori miR-279c stem-loop
Gene family MIPF0000184; mir-279
Literature search

9 open access papers mention bmo-mir-279c
(14 sentences)

Stem-loop
   -    au   ug       u  cu      u    u  ua 
5'  ugau  uug  ggcgagu ug  ucuggu caug uu  u
    ||||  |||  ||||||| ||  |||||| |||| ||   
3'  acua  gac  cugcuca ac  agauca guac ag  a
   a    cc   gu       u  cu      -    u  uu 
Get sequence
Deep sequencing
63831 reads, 1.13e+04 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581681.1: 2936836-2936915 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-279c
bmo-mir-279bNW_004581681.1: 2936576-2936652 [+]
bmo-mir-279cNW_004581681.1: 2936836-2936915 [+]
Database links

Mature sequence bmo-miR-279c-5p

Accession MIMAT0013610
Previous IDsbmo-miR-279c*
Sequence

11 - 

gggcgaguuugcuucugguuca

 - 32

Get sequence
Deep sequencing14 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence bmo-miR-279c-3p

Accession MIMAT0013611
Previous IDsbmo-miR-279c
Sequence

49 - 

ugacuagauccauacucgucug

 - 70

Get sequence
Deep sequencing63817 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).