Stem-loop sequence bmo-mir-279b

AccessionMI0012298 (change log)
DescriptionBombyx mori miR-279b stem-loop
Gene family MIPF0000184; mir-279
Literature search

8 open access papers mention bmo-mir-279b
(13 sentences)

Stem-loop
   ---uuu   g         a         ua    c   c 
5'       gua uuaaugggu uaggucuag  ucac ggg u
         ||| ||||||||| |||||||||  |||| |||  
3'       cgu aguuacuca aucuagauc  agug cuu g
   gguauu   g         c         --    u   a 
Get sequence
Deep sequencing
31905 reads, 5.23e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581681.1: 2936576-2936652 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-279b
bmo-mir-279bNW_004581681.1: 2936576-2936652 [+]
bmo-mir-279cNW_004581681.1: 2936836-2936915 [+]
Database links

Mature sequence bmo-miR-279b-5p

Accession MIMAT0013608
Previous IDsbmo-miR-279b*
Sequence

11 - 

auggguauaggucuaguau

 - 29

Get sequence
Deep sequencing225 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence bmo-miR-279b-3p

Accession MIMAT0013609
Previous IDsbmo-miR-279b
Sequence

46 - 

ugacuagaucuacacucauuga

 - 67

Get sequence
Deep sequencing31680 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).