Stem-loop sequence bmo-mir-279d

AccessionMI0012297 (change log)
DescriptionBombyx mori miR-279d stem-loop
Gene family MIPF0000184; mir-279
Literature search

8 open access papers mention bmo-mir-279d
(13 sentences)

Stem-loop
   --u   u    c         cc       u    uug 
5'    ucc caga gaugaguga  guuuagu caag   u
      ||| |||| |||||||||  ||||||| ||||   c
3'    ggg gucu cuauucacu  uagauca guuc   a
   cac   c    c         uu       -    uua 
Get sequence
Deep sequencing
631 reads, 66.7 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582019.1: 739120-739195 [+]
intergenic
Database links

Mature sequence bmo-miR-279d-5p

Accession MIMAT0013606
Previous IDsbmo-miR-279d*
Sequence

11 - 

gaugagugaccguuuaguucaa

 - 32

Get sequence
Deep sequencing20 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

Mature sequence bmo-miR-279d-3p

Accession MIMAT0013607
Previous IDsbmo-miR-279d
Sequence

45 - 

ugacuagauuuucacuuauccu

 - 66

Get sequence
Deep sequencing611 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).