Stem-loop sequence bmo-mir-998

AccessionMI0012295
DescriptionBombyx mori miR-998 stem-loop
Gene family MIPF0000952; mir-998
Stem-loop
   cu      c      cc       cg      -  g 
5'   cggucg gagcug  ucccgug  gcugca gu c
     |||||| ||||||  |||||||  |||||| ||  
3'   gccggc cucgac  aggguac  cgaugu cg u
   uc      a      uu       ca      g  c 
Get sequence
Deep sequencing
692 reads, 232 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf2655: 1163490-1163562 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-998
bmo-mir-11nscaf2655: 1162545-1162620 [+]
bmo-mir-998nscaf2655: 1163490-1163562 [+]

Mature sequence bmo-miR-998

Accession MIMAT0013603
Sequence

44 - 

uagcaccaugggauucagcu

 - 63

Get sequence
Deep sequencing621 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).