Stem-loop sequence bmo-mir-998

AccessionMI0012295 (change log)
DescriptionBombyx mori miR-998 stem-loop
Gene family MIPF0000952; mir-998
Stem-loop
   cu      c      cc       cg      -  g 
5'   cggucg gagcug  ucccgug  gcugca gu c
     |||||| ||||||  |||||||  |||||| ||  
3'   gccggc cucgac  aggguac  cgaugu cg u
   uc      a      uu       ca      g  c 
Get sequence
Deep sequencing
721 reads, 66.7 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581691.1: 1166010-1166082 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-998
bmo-mir-11NW_004581691.1: 1165065-1165140 [+]
bmo-mir-998NW_004581691.1: 1166010-1166082 [+]
Database links

Mature sequence bmo-miR-998

Accession MIMAT0013603
Sequence

44 - 

uagcaccaugggauucagcu

 - 63

Get sequence
Deep sequencing721 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).