Stem-loop sequence bmo-mir-33

AccessionMI0012293 (change log)
DescriptionBombyx mori miR-33 stem-loop
Gene family MIPF0000070; mir-33
Literature search

4 open access papers mention bmo-mir-33
(5 sentences)

Stem-loop
   --   ag  a  -g   a        gc       cg   c 
5'   uaa  cg ga  ugc uuguaguu  auugcac  guu c
     |||  || ||  ||| ||||||||  |||||||  ||| a
3'   auu  gc cu  acg aacaucag  uaacgug  caa u
   ug   aa  c  aa   g        ua       --   u 
Get sequence
Deep sequencing
1104 reads, 100 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582008.1: 9552124-9552203 [+]
intergenic
Database links

Mature sequence bmo-miR-33-5p

Accession MIMAT0013599
Previous IDsbmo-miR-33
Sequence

11 - 

gugcauuguaguugcauugca

 - 31

Get sequence
Deep sequencing976 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

Mature sequence bmo-miR-33-3p

Accession MIMAT0013600
Previous IDsbmo-miR-33*
Sequence

49 - 

caauaugacuacaaggcaaauc

 - 70

Get sequence
Deep sequencing128 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).