Stem-loop sequence bmo-mir-33

Accession MI0012293
Description Bombyx mori miR-33 stem-loop
Gene family MIPF0000070; mir-33
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-33. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-33 is a family of microRNA precursors, which are processed by the Dicer enzyme to give mature microRNAs. miR-33 is found in several animal species, including humans. In some species there is a single member of this family which gives the mature product mir-33. In humans there are two members of this family called mir-33a and mir-33b, which are located in intronic regions within two protein-coding genes for Sterol regulatory element-binding proteins (SREBP-2 and SREBP-1) respectively.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--   ag  a  -g   a        gc       cg   c 
  uaa  cg ga  ugc uuguaguu  auugcac  guu c
  |||  || ||  ||| ||||||||  |||||||  ||| a
  auu  gc cu  acg aacaucag  uaacgug  caa u
ug   aa  c  aa   g        ua       --   u 
Get sequence
Deep sequencing
952 reads, 3 experiments
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf1898: 9530344-9530423 [+]
intergenic

Mature sequence bmo-miR-33-5p

Accession MIMAT0013599
Previous IDs bmo-miR-33
Sequence

11 - 

gugcauuguaguugcauugca

 - 31

Get sequence
Deep sequencing 847 reads, 3 experiments
Evidence experimental; Solexa [1], SOLID [2]
Validated targets

Mature sequence bmo-miR-33-3p

Accession MIMAT0013600
Previous IDs bmo-miR-33*
Sequence

49 - 

caauaugacuacaaggcaaauc

 - 70

Get sequence
Deep sequencing 105 reads, 3 experiments
Evidence experimental; Solexa [1], SOLID [2]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).