Stem-loop sequence bmo-mir-316

AccessionMI0012292
DescriptionBombyx mori miR-316 stem-loop
Gene family MIPF0000254; mir-316
Stem-loop
   --ug      uuu u       c         c    uuuu 
5'     cauaaa   g cuuuuuc gcuuugcug ugau    u
       ||||||   | ||||||| ||||||||| ||||    u
3'     guauuu   c ggaaaag ugaaacggc acug    c
   aaga      ccu u       -         a    caug 
Get sequence
Deep sequencing
23 reads, 7.85 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf3034: 2951761-2951842 [+]
intergenic

Mature sequence bmo-miR-316-5p

Accession MIMAT0013597
Previous IDsbmo-miR-316*
Sequence

11 - 

ugucuuuuuccgcuuugcugcug

 - 33

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1], SOLID [2]

Mature sequence bmo-miR-316-3p

Accession MIMAT0013598
Previous IDsbmo-miR-316
Sequence

51 - 

acggcaaagugaaaaggucucc

 - 72

Get sequence
Deep sequencing15 reads, 2 experiments
Evidence experimental; Illumina [1], SOLID [2]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).