Stem-loop sequence bmo-mir-100

AccessionMI0012291 (change log)
DescriptionBombyx mori miR-100 stem-loop
Gene family MIPF0000033; mir-10
Literature search

9 open access papers mention bmo-mir-100
(17 sentences)

Stem-loop
   cauuaagccucuuuaa    -   ccg    uc   ac    gc       --uc    gggacuccguccaa 
5'                 cugg aac   uaga  cga  uugu  gcuauug    guug              u
                   |||| |||   ||||  |||  ||||  |||||||    ||||               
3'                 ggcc uug   aucu  gcu  aaca  cgguaac    cagc              c
   --aaaccaaaacuaac    g   aaa    ua   au    -a       uuau    gauagcaaugcgcg 
Get sequence
Deep sequencing
92309 reads, 1.68e+04 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582019.1: 3376172-3376313 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-100
bmo-mir-100NW_004582019.1: 3376172-3376313 [-]
bmo-mir-2795NW_004582019.1: 3375941-3376015 [-]
bmo-let-7NW_004582019.1: 3373685-3373788 [-]
Database links

Mature sequence bmo-miR-100

Accession MIMAT0013596
Sequence

21 - 

aacccguagauccgaacuugug

 - 42

Get sequence
Deep sequencing92309 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).