Stem-loop sequence isc-mir-993

AccessionMI0012289 (change log)
DescriptionIxodes scapularis miR-993 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention isc-mir-993
(3 sentences)

Stem-loop
   cacgagccc       uc    c       c          -u  acua 
5'          uucguaa  uacc uguagaa cgggcuuuug  ag    g
            |||||||  |||| ||||||| ||||||||||  ||     
3'          aagcguu  augg acaucuu gcucgaagac  uc    c
   ------cua       cu    -       u          uu  ccag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS891538: 3285820-3285911 [-]
intergenic
Database links

Mature sequence isc-miR-993

Accession MIMAT0012709
Sequence

61 - 

gaagcucguuucuacagguaucu

 - 83

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).