Stem-loop sequence isc-mir-96

AccessionMI0012288 (change log)
DescriptionIxodes scapularis miR-96 stem-loop
Gene family MIPF0000072; mir-96
Literature search

1 open access papers mention isc-mir-96
(2 sentences)

Stem-loop
   ----- u  a    gcc    -   u          g    -       -  uuc 
5'      g ca acuc   uucc guu uuuggcacua caca uuuuugu gu   g
        | || ||||   |||| ||| |||||||||| |||| ||||||| ||   a
3'      c gu ugag   aagg uaa gaacugugau gugu aaaaaca ca   u
   cguaa -  c    ---    a   c          g    u       g  ucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS633978: 113205-113305 [+]
intergenic
Database links

Mature sequence isc-miR-96

Accession MIMAT0012708
Sequence

21 - 

uuuggcacuagcacauuuuugu

 - 42

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).