Stem-loop sequence isc-mir-87

AccessionMI0012287 (change log)
DescriptionIxodes scapularis miR-87 stem-loop
Gene family MIPF0000152; mir-87
Literature search

1 open access papers mention isc-mir-87
(2 sentences)

Stem-loop
   cacacauc  g    uu   u  c         a    u   aa    uuca 
5'         uc cuuc  gac gc ugccugaaa uuug cuc  accu    u
           || ||||  ||| || ||||||||| |||| |||  ||||     
3'         ag gagg  cug ug guggacuuu aaac gag  ugga    a
   -gucacac  -    uu   u  u         g    -   --    ugug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS929532: 41471-41571 [-]
intergenic
Database links

Mature sequence isc-miR-87

Accession MIMAT0012707
Sequence

61 - 

gugagcaaaguuucaggugug

 - 81

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).