Stem-loop sequence isc-mir-8

AccessionMI0012286 (change log)
DescriptionIxodes scapularis miR-8 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   -     accgagca     ca       -   a     c      uugag 
5'  cagcg        cccgu  acaucuu acc gacag auuaga     c
    |||||        |||||  ||||||| ||| ||||| ||||||      
3'  gucgc        gggcg  uguagaa ugg cuguc uaaucu     c
   u     ------aa     cc       a   a     a      uuagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS755496: 12152-12245 [-]
intergenic
Database links

Mature sequence isc-miR-8

Accession MIMAT0012706
Sequence

58 - 

uaauacugucagguaaagauguc

 - 80

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).