Stem-loop sequence isc-mir-79

AccessionMI0012285 (change log)
DescriptionIxodes scapularis miR-79 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention isc-mir-79
(7 sentences)

Stem-loop
   agaggaugaa   ---    a  uuuu       u        g     -  ga 
5'           ggc   gcug ua    cuuuggu aucuagcu uauga gu  u
             |||   |||| ||    ||||||| |||||||| ||||| ||  a
3'           ccg   cgac au    gaaacca uggaucga auacu ca  u
   ---cguaaug   uca    a  ---u       u        a     a  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS885551: 436490-436590 [+]
intergenic
Database links

Mature sequence isc-miR-79

Accession MIMAT0012705
Sequence

61 - 

auaaagcuagguuaccaaaguua

 - 83

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).