Stem-loop sequence isc-mir-750

AccessionMI0012284 (change log)
DescriptionIxodes scapularis miR-750 stem-loop
Gene family MIPF0000796; mir-750
Stem-loop
   gguug    --u  -   uc          ---------   g   -      - uu 
5'      gccg   cc cac  gaguuggaag         ugg auc cugaca c  g
        ||||   || |||  ||||||||||         ||| ||| |||||| |   
3'      uggc   gg gug  cucgaccuuc         acc ugg ggcugu g  a
   -uuua    cau  a   ga          ucaaucuag   g   u      c cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS874548: 52964-53064 [-]
intergenic
Database links

Mature sequence isc-miR-750

Accession MIMAT0012704
Sequence

61 - 

ccagaucuaacucuuccagcuca

 - 83

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).