Stem-loop sequence isc-mir-71

AccessionMI0012283 (change log)
DescriptionIxodes scapularis miR-71 stem-loop
Gene family MIPF0000278; mir-71
Literature search

1 open access papers mention isc-mir-71
(4 sentences)

Stem-loop
   gagu     -      a    cug       u             a  -u  a 
5'     uugca guguug uucc   aaagaca ggguagugagaug gu  ug c
       ||||| |||||| ||||   ||||||| ||||||||||||| ||  ||  
3'     gacgu cacgau aagg   uuucugu uccaucacucuac cg  ac u
   ---u     g      a    uug       -             -  uu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS799611: 45689-45789 [-]
intergenic
Clustered miRNAs
< 10kb from isc-mir-71
isc-mir-71DS799611: 45689-45789 [-]
isc-mir-2bDS799611: 45547-45647 [-]
isc-mir-2aDS799611: 45157-45257 [-]
Database links

Mature sequence isc-miR-71

Accession MIMAT0012703
Sequence

22 - 

ugaaagacauggguagugagaug

 - 44

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).