Stem-loop sequence isc-mir-7

AccessionMI0012282 (change log)
DescriptionIxodes scapularis miR-7 stem-loop
Gene family MIPF0000022; mir-7
Literature search

1 open access papers mention isc-mir-7
(1 sentences)

Stem-loop
   ggggcccuc    c    a  c          guug     uc 
5'          ccgu ugga ga uagugauuuu    uucug  a
            |||| |||| || ||||||||||    |||||  a
3'          ggca gccu cu aucacuaaag    aaggu  a
   -------gu    a    -  -          aaca     uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS629750: 8358-8437 [-]
intergenic
Database links

Mature sequence isc-miR-7

Accession MIMAT0012702
Sequence

15 - 

uggaagacuagugauuuuguugu

 - 37

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).