Stem-loop sequence isc-mir-307

AccessionMI0012281 (change log)
DescriptionIxodes scapularis miR-307 stem-loop
Gene family MIPF0000293; mir-67
Literature search

1 open access papers mention isc-mir-307
(1 sentences)

Stem-loop
     u  ag    -a      uc         uuu  c       uaa   g 
5' gc ug  ucgg  gggccu  cucacucag   gg uguggug   cgg c
   || ||  ||||  ||||||  |||||||||   || |||||||   |||  
3' cg ac  agcc  uccgga  gagugaguu   cc acacuac   gcu g
     c  cg    gc      gu         ccu  a       cca   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS911299: 1700291-1700391 [-]
intergenic
Database links

Mature sequence isc-miR-307

Accession MIMAT0012701
Sequence

61 - 

ucacaaccuccuugagugag

 - 80

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).