Stem-loop sequence isc-mir-375

AccessionMI0012280 (change log)
DescriptionIxodes scapularis miR-375 stem-loop
Gene family MIPF0000114; mir-375
Stem-loop
   cacaaaa   -    a  -g             cc  u       uggaac 
5'        cca gccg gu  cugacucgagcug  cg gcaaaac      c
          ||| |||| ||  |||||||||||||  || |||||||      a
3'        ggu uggc ca  gauugagcucggc  gc uguuuug      c
   -aacaca   g    -  aa             uu  u       uugcgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS966815: 32746-32846 [-]
intergenic
Database links

Mature sequence isc-miR-375

Accession MIMAT0012700
Sequence

61 - 

uuuguucguucggcucgaguua

 - 82

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).