Stem-loop sequence isc-mir-317

AccessionMI0012279 (change log)
DescriptionIxodes scapularis miR-317 stem-loop
Gene family MIPF0000144; mir-317
Literature search

1 open access papers mention isc-mir-317
(1 sentences)

Stem-loop
   uucgacaug   u  c     -a          --   a    c   -gu  g 
5'          gcc cg cugac  guguaccacc  cug guuc cac   gc u
            ||| || |||||  ||||||||||  ||| |||| |||   ||  
3'          cgg gc gacug  uauauggugg  gac caag gug   cg u
   ---caucua   c  u     ac          uc   a    u   acc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS891538: 57423-57523 [-]
intergenic
Database links

Mature sequence isc-miR-317

Accession MIMAT0012699
Sequence

61 - 

ugaacacagcuggugguauaucagu

 - 85

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).