Stem-loop sequence isc-mir-315

AccessionMI0012278 (change log)
DescriptionIxodes scapularis miR-315 stem-loop
Gene family MIPF0000141; mir-315
Literature search

1 open access papers mention isc-mir-315
(1 sentences)

Stem-loop
   --------cu   gua    uucu   cu      u  ug   a      g  gca 
5'           gcg   cucc    cag  uuugau gu  cuc gaaggc ug   a
             |||   ||||    |||  |||||| ||  ||| |||||| ||   u
3'           cgc   gagg    guu  aaacua ca  gag cuuccg ac   c
   acugcuuaac   --a    ---u   cu      u  gu   -      a  agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS711462: 57333-57433 [+]
intergenic
Database links

Mature sequence isc-miR-315

Accession MIMAT0012698
Sequence

21 - 

uuuugauuguugcucagaaggc

 - 42

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).