Stem-loop sequence isc-mir-2b

AccessionMI0012277 (change log)
DescriptionIxodes scapularis miR-2b stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   cuaau   ---   c        -         - a      a    cuc  u 
5'      guu   uuc ugugcagc cgucaaagg g cuguga augu   cc u
        |||   ||| |||||||| ||||||||| | |||||| ||||   || c
3'      cag   aag acaugucg guaguuucc c gacacu uacg   gg u
   ---cu   gcu   c        a         a c      a    acu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS799611: 45547-45647 [-]
intergenic
Clustered miRNAs
< 10kb from isc-mir-2b
isc-mir-71DS799611: 45689-45789 [-]
isc-mir-2bDS799611: 45547-45647 [-]
isc-mir-2aDS799611: 45157-45257 [-]
Database links

Mature sequence isc-miR-2b

Accession MIMAT0012697
Sequence

61 - 

uaucacagccaccuuugaugagc

 - 83

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).