Stem-loop sequence isc-mir-2a

AccessionMI0012276 (change log)
DescriptionIxodes scapularis miR-2a stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
   uuuc    ac u c    u             -     c       ugucu 
5'     guag  g c cacc cuguucgucaaag uggcu ugaugug     c
       ||||  | | |||| ||||||||||||| ||||| |||||||     u
3'     cauc  c g gugg ggcgaguaguuuc accga acuauac     u
   ---u    cu u a    u             g     c       uuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS799611: 45157-45257 [-]
intergenic
Clustered miRNAs
< 10kb from isc-mir-2a
isc-mir-71DS799611: 45689-45789 [-]
isc-mir-2bDS799611: 45547-45647 [-]
isc-mir-2aDS799611: 45157-45257 [-]
Database links

Mature sequence isc-miR-2a

Accession MIMAT0012696
Sequence

61 - 

uaucacagccagcuuugaugagc

 - 83

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).