Stem-loop sequence isc-mir-285

AccessionMI0012275 (change log)
DescriptionIxodes scapularis miR-285 stem-loop
Gene family MIPF0000009; mir-29
Literature search

1 open access papers mention isc-mir-285
(1 sentences)

Stem-loop
   auccaaaucca  c      -c          uu     --  u    g  u 
5'            uc uugggu  acugaguucg  uggug  gg agaa ug g
              || ||||||  ||||||||||  |||||  || |||| ||  
3'            ag aaccua  ugacuuaagu  accac  uc ucuu ac u
   ------gcuug  a      cu          uu     ga  -    a  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence isc-miR-285

Accession MIMAT0012695
Sequence

61 - 

uagcaccauuugaauucaguuc

 - 82

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).