Stem-loop sequence isc-mir-279

AccessionMI0012274 (change log)
DescriptionIxodes scapularis miR-279 stem-loop
Gene family MIPF0000184; mir-279
Literature search

1 open access papers mention isc-mir-279
(4 sentences)

Stem-loop
   ------ccua     g    u     c    cc       c   u aa 
5'           ucguu cuau gauga ugug  ucuaguc aug g  u
             ||||| |||| ||||| ||||  ||||||| ||| |  c
3'           ggcga gaua cuacu acac  agaucag uac c  u
   gcuguuucaa     a    c     c    cu       -   u ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence isc-miR-279

Accession MIMAT0012694
Sequence

52 - 

ugacuagauccacacucaucca

 - 73

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).