Stem-loop sequence isc-mir-275

AccessionMI0012273 (change log)
DescriptionIxodes scapularis miR-275 stem-loop
Gene family MIPF0000187; mir-275
Literature search

1 open access papers mention isc-mir-275
(4 sentences)

Stem-loop
   gucuuu  --     uu    - ua        a         ug     acg g 
5'       cc  ucccg  gccu c  cgugcugc ucaggugcu  ugacu   c u
         ||  |||||  |||| |  |||||||| |||||||||  |||||   |  
3'       gg  ggggc  cgga g  gcgcgaug aguccaugg  acuga   g u
   -----u  uc     uu    a gc        a         --     -aa c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS945001: 243239-243339 [-]
intergenic
Database links

Mature sequence isc-miR-275

Accession MIMAT0012693
Sequence

61 - 

ucagguaccugaaguagcgcgcg

 - 83

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).