Stem-loop sequence isc-mir-263a

AccessionMI0012272 (change log)
DescriptionIxodes scapularis miR-263a stem-loop
Gene family MIPF0000122; mir-263
Literature search

1 open access papers mention isc-mir-263a
(1 sentences)

Stem-loop
   uugccuu    c  u     a           a   u      --gg   u 
5'        ccua cu ccguc auggcacugga gaa ucacgg    ucu g
          |||| || ||||| ||||||||||| ||| ||||||    |||  
3'        ggau gg gguag ugucguggccu cuu agugcc    aga a
   -ucagcc    c  c     g           -   c      auaa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS633978: 93542-93641 [+]
intergenic
Database links

Mature sequence isc-miR-263a

Accession MIMAT0012692
Sequence

21 - 

aauggcacuggaagaauucac

 - 41

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).