Stem-loop sequence isc-mir-252b

AccessionMI0012271 (change log)
DescriptionIxodes scapularis miR-252b stem-loop
Gene family MIPF0000285; mir-252
Literature search

1 open access papers mention isc-mir-252b
(1 sentences)

Stem-loop
   caug         ------------    cuuua      a   cc       -a  -    
5'     uguguuuua            aguc     aguagu gug  gcaggua  gg gcu 
       |||||||||            ||||     |||||| |||  |||||||  || || u
3'     acgcaaagu            ucag     ucguca cac  cguccau  uc cgg 
   --ca         caccuaaaguag    -----      a   -a       gg  a    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence isc-miR-252b

Accession MIMAT0012691
Sequence

20 - 

uuaaguaguagugccgcaggua

 - 41

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).