Stem-loop sequence isc-mir-219

AccessionMI0012270 (change log)
DescriptionIxodes scapularis miR-219 stem-loop
Gene family MIPF0000044; mir-219
Literature search

1 open access papers mention isc-mir-219
(1 sentences)

Stem-loop
   ----a  g  c            g    u    aa     a      --u  g 
5'      cg aa caguuccaagcu ugau gucc  acgca uucuug   gc a
        || || |||||||||||| |||| ||||  ||||| ||||||   ||  
3'      gc uu gucaagguuugg acua cagg  ugugu aagaac   ug u
   acaca  g  a            g    -    gc     c      cau  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS658596: 21107-21207 [-]
intergenic
Database links

Mature sequence isc-miR-219

Accession MIMAT0012690
Sequence

21 - 

ugauuguccaaacgcaauucuu

 - 42

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).