Stem-loop sequence isc-mir-184

AccessionMI0012269 (change log)
DescriptionIxodes scapularis miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   cggccuucc  uu     uu         -   ga        -a  g ug 
5'          gu  ccacg  uccuuauca uuc  cuguccag  cu c  u
            ||  |||||  ||||||||| |||  ||||||||  || |   
3'          cg  ggugu  gggaauagu aag  ggcagguc  ga g  u
   aacucauua  uu     uc         c   -a        ca  g uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS803854: 570-670 [-]
intergenic
Database links

Mature sequence isc-miR-184

Accession MIMAT0012689
Sequence

61 - 

uggacggagaacugauaagggc

 - 82

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).