Stem-loop sequence isc-mir-153

AccessionMI0012268 (change log)
DescriptionIxodes scapularis miR-153 stem-loop
Gene family MIPF0000050; mir-153
Literature search

1 open access papers mention isc-mir-153
(2 sentences)

Stem-loop
   cuu   cucu          cu                 g       g   a 
5'    ggc    cuccguugcg  caucauuuuugugauug ugcaauu ugc c
      |||    ||||||||||  ||||||||||||||||| ||||||| |||  
3'    ucg    ggggcggcgc  guagugaaaacacugau acguuaa acg c
   -uc   --uc          ug                 -       -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence isc-miR-153

Accession MIMAT0012688
Sequence

61 - 

uugcauagucacaaaagugaug

 - 82

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).