Stem-loop sequence isc-mir-137

AccessionMI0012267 (change log)
DescriptionIxodes scapularis miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

1 open access papers mention isc-mir-137
(2 sentences)

Stem-loop
   ----ug   gau    uc    - c         aauu  g       cu   a 
5'       gug   ucug  cugg g cguguauuc    gc aauaaca  cuu c
         |||   ||||  |||| | |||||||||    || |||||||  ||| c
3'       cgc   agac  ggcc c gcacauaag    cg uuauugu  gaa u
   uucuua   ---    ca    g u         aguu  -       -c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence isc-miR-137

Accession MIMAT0012687
Sequence

61 - 

uauugcuugagaauacacgucg

 - 82

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).