Stem-loop sequence isc-mir-133

AccessionMI0012266 (change log)
DescriptionIxodes scapularis miR-133 stem-loop
Gene family MIPF0000029; mir-133
Literature search

1 open access papers mention isc-mir-133
(5 sentences)

Stem-loop
   -------------------u       c     cc         c  --caua      au 
5'                     uagcugg ugaag  gggccaaau gu      auuccu  g
                       ||||||| |||||  ||||||||| ||      ||||||   
3'                     gucgacc acuuc  ccugguuua ca      uaagga  a
   aacaacucgauacgguuggu       a     -c         -  uaacuc      aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence isc-miR-133

Accession MIMAT0012686
Sequence

61 - 

uugguccccuucaaccagcugu

 - 82

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).