miRNA Entry for MI0012266

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

mir-133 microRNA precursor family

Predicted secondary structure and sequence conservation of mir-133
Identifiers
Symbol	mir-133
Rfam	RF00446
miRBase	MI0000450
miRBase family	MIPF0000029
Other data
RNA type	Gene; miRNA
Domain(s)	Eukaryota
GO	0035195 0035068
SO	0001244

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice.^[1] Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.^[2]

1 Regulation
2 Targets of miR-133
3 References
4 Further reading
5 External links

[edit] Regulation

It is proposed that Insulin activates the translocation of SREBP-1c (BHLH) active form from the endoplasmic reticulum (ER) to the nucleus and, concomittantly, induces SREPB-1c expression via PI3K signaling pathway. SREBP-1c mediates MEF2C downregulation through a mechanism that remains to be determined. As a consequence of lower MEF2C binding on their enhancer region, the transcription of miR-1 and miR-133a is reduced, leading to decreased levels of their mature forms in muscle, after insulin treatment. Altered activation of PI3K and SREBP-1c may explain the defective regulation of miR-1 and miR-133a expression in response to insulin in muscle of type 2 diabetic patients.^[3]

[edit] Targets of miR-133

microRNAs act by lowering the expression of genes by binding to target sites in the 3' UTR of the mRNAs. Luo et al.. demonstrated that the HCN2 K⁺ channel gene contains a target of miR-133.^[4] Yin et al.. showed that the Mps1 kinase gene in zebrafish is a target.^[5] Luo et al.. demonstrated that the voltage gated K⁺ channel KCNQ1 is a target.^[6] Boutz et al.. showed that nPTB (neuronal polypyrimidine tract-binding protein) is a target and likely contains two target sites for miR-133.^[7] Xiao et al.. show that ether-a-go-go related gene (ERG) a K⁺ channel is a target of miR-133.^[8]

miR-133 directly and negatively regulates NFATc4.^[9]^[10]

RhoA expression is negatively regulated by miR-133a in bronchial smooth muscles (BSM)and miR-133a downregulation causes an upregulation of RhoA, resulting in an augmentation of contraction and BSM hyperresponsiveness.^[11]

BMP2 downregulates multiple mIRs, of which one, miR-133, directly inhibits Runx2, an early BMP response gene essential for bone formation. Although miR-133 is known to promote MEF-2-dependent myogenesis, it also inhibits Runx2-mediated osteogenesis. BMP2 controls bone cell determination by inducing miRNAs that target muscle genes but mainly by down-regulating multiple miRNAs that constitute an osteogenic program, thereby releasing from inhibition pathway components required for cell lineage commitment establish a mechanism for BMP morphogens to selectively induce a tissue-specific phenotype and suppress alternative lineages.^[12]

Nicotine activates α7-nAChR and downregulates the levels of miR-133 and miR-590 leading to significant upregulation of expression of TGF-β1 and TGF-βRII at the protein level establishing miR-133 and miR-590 as repressors of TGF-β1 and TGF-βRII.^[13]

miR-133 enhances myoblast proliferation by repressing serum response factor (SRF)^[14]

mIR-133 supressses SP1 expression^[15]

In rats, miR-133b is expressed in retinal dopaminergicamacrine cell, and this expression is significantly increased during early stage during retinal degeneration. This overexpression leads to downregulation of the transcription factor PITX3.^[16]

[edit] References

^ Lagos-Quintana, M; Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T (2002). "Identification of tissue-specific microRNAs from mouse". Curr Biol 12 (9): 735–739. doi:10.1016/S0960-9822(02)00809-6. PMID 12007417.
^ Ivey KN, Muth A, Arnold J, et al (March 2008). "MicroRNA Regulation of Cell Lineages in Mouse and Human Embryonic Stem Cells". Cell Stem Cell 2 (3): 219–29. doi:10.1016/j.stem.2008.01.016. PMC 2293325. PMID 18371447. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2293325/.
^ Granjon A, Gustin MP, Rieusset J, et al. (November 2009). "The microRNA signature in response to insulin reveals its implication in the transcriptional action of insulin in human skeletal muscle and the role of a sterol regulatory element-binding protein-1c/myocyte enhancer factor 2C pathway". Diabetes 58 (11): 2555–64. doi:10.2337/db09-0165. PMC 2768160. PMID 19720801. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2768160/.
^ Luo X, Lin H, Pan Z, et al (May 2008). "Downregulation of MIRNA-1/MIRNA-133 contributes to re-expression of pacemaker channel genes HCN2 and HCN4 in hypertrophic heart". J. Biol. Chem. 283 (29): 20045–52. doi:10.1074/jbc.M801035200. PMID 18458081.
^ Yin VP, Thomson JM, Thummel R, Hyde DR, Hammond SM, Poss KD (March 2008). "Fgf-dependent depletion of microRNA-133 promotes appendage regeneration in zebrafish". Genes Dev. 22 (6): 728–33. doi:10.1101/gad.1641808. PMC 2275425. PMID 18347091. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2275425/.
^ Luo X, Xiao J, Lin H, et al (August 2007). "Transcriptional activation by stimulating protein 1 and post-transcriptional repression by muscle-specific microRNAs of IKs-encoding genes and potential implications in regional heterogeneity of their expressions". J. Cell. Physiol. 212 (2): 358–67. doi:10.1002/jcp.21030. PMID 17443681. (Retracted. If this is intentional, please replace {{Retracted}} with {{Retracted|intentional=yes}}.)
^ Boutz PL, Chawla G, Stoilov P, Black DL (January 2007). "MicroRNAs regulate the expression of the alternative splicing factor nPTB during muscle development". Genes Dev. 21 (1): 71–84. doi:10.1101/gad.1500707. PMC 1759902. PMID 17210790. //www.ncbi.nlm.nih.gov/pmc/articles/PMC1759902/.
^ Xiao J, Luo X, Lin H, et al (April 2007). "MicroRNA miR-133 represses HERG K+ channel expression contributing to QT prolongation in diabetic hearts". J. Biol. Chem. 282 (17): 12363–7. doi:10.1074/jbc.C700015200. PMID 17344217.
^ Li, Q.; Lin, X.; Yang, X.; Chang, J. (2010). "NFATc4 is negatively regulated in miR-133a-mediated cardiomyocyte hypertrophic repression". AJP: Heart and Circulatory Physiology 298 (5): H1340–H1347. doi:10.1152/ajpheart.00592.2009. PMID 20173049. edit
^ Dong, D. -L.; Chen, C.; Huo, R.; Wang, N.; Li, Z.; Tu, Y. -J.; Hu, J. -T.; Chu, X. et al. (2010). "Reciprocal Repression Between MicroRNA-133 and Calcineurin Regulates Cardiac Hypertrophy: A Novel Mechanism for Progressive Cardiac Hypertrophy". Hypertension 55 (4): 946–952. doi:10.1161/HYPERTENSIONAHA.109.139519. PMID 20177001. edit
^ Chiba, Y.; Misawa, M. (2010). "MicroRNAs and their therapeutic potential for human diseases: MiR-133a and bronchial smooth muscle hyperresponsiveness in asthma". Journal of pharmacological sciences 114 (3): 264–268. doi:10.1254/jphs.10R10FM. PMID 20953121. edit
^ Li Z, Hassan MQ, Volinia S, et al. (September 2008). "A microRNA signature for a BMP2-induced osteoblast lineage commitment program". Proc. Natl. Acad. Sci. U.S.A. 105 (37): 13906–11. doi:10.1073/pnas.0804438105. PMC 2544552. PMID 18784367. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2544552/.
^ Cardiovasc Res (2009) 83 (3): 465-472. doi:10.1093/cvr/cvp130
^ Nature Genetics 38, 228 - 233 (2005) Published online: 25 December 2005 | doi:10.1038/ng1725
^ Circulation Research. 2011; 109: 880-893 Published online before print August 18, 2011, doi:10.1161/CIRCRESAHA.111.240150
^ Li, Y.; Li, C.; Chen, Z.; He, J.; Tao, Z.; Yin, Z. Q. (2012). "A MicroRNA, mir133b, suppresses melanopsin expression mediated by failure dopaminergic amacrine cells in RCS rats". Cellular Signalling 24 (3): 685–698. doi:10.1016/j.cellsig.2011.10.017. PMID 22101014. edit

[edit] Further reading

Eitel, I; Adams, V; Dieterich, P; Fuernau, G; de Waha, S; Desch, S; Schuler, G; Thiele, H (2012 Nov). "Relation of circulating MicroRNA-133a concentrations with myocardial damage and clinical prognosis in ST-elevation myocardial infarction.". American heart journal 164 (5): 706–14. PMID 23137501.

[edit] External links

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

Mature sequence isc-miR-133
Accession	MIMAT0012686
Sequence	61 - uugguccccuucaaccagcugu - 82 Get sequence
Evidence	not experimental

miRBase

Stem-loop sequence isc-mir-133

Contents

[edit] Regulation

[edit] Targets of miR-133

[edit] References

[edit] Further reading

[edit] External links

Mature sequence isc-miR-133

References

References
1	PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).