Stem-loop sequence isc-mir-124

AccessionMI0012265 (change log)
DescriptionIxodes scapularis miR-124 stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention isc-mir-124
(1 sentences)

Stem-loop
   --gaccccuu     aacg    cc            c      au    cc 
5'           gcgug    cucu  guauucacugcg gccuug  gugc  a
             |||||    ||||  |||||||||||| ||||||  ||||   
3'           cgcac    gaga  cguaaguggcgc cggaau  uaug  a
   acuaaucguu     ---g    ac            a      ac    ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS840700: 85144-85244 [+]
intergenic
Database links

Mature sequence isc-miR-124

Accession MIMAT0012685
Sequence

61 - 

uaaggcacgcggugaaugccaag

 - 83

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).