Stem-loop sequence isc-mir-12

AccessionMI0012264 (change log)
DescriptionIxodes scapularis miR-12 stem-loop
Gene family MIPF0000181; mir-12
Literature search

1 open access papers mention isc-mir-12
(1 sentences)

Stem-loop
   ---gaucgc        u   ac           u           -  g u 
5'          guuggggc ggg  ugaguauuaca cagguacuggu cu g u
            |||||||| |||  ||||||||||| ||||||||||| || |  
3'          cggccccg ucc  acuuauagugu gucuaugacca gg u g
   gcgucaaau        c   cc           -           u  g c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS942119: 45739-45839 [-]
intergenic
Clustered miRNAs
< 10kb from isc-mir-12
isc-mir-5307DS942119: 46308-46417 [-]
isc-mir-12DS942119: 45739-45839 [-]
Database links

Mature sequence isc-miR-12

Accession MIMAT0012684
Sequence

21 - 

ugaguauuacaucagguacuggu

 - 43

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).