Stem-loop sequence isc-mir-100

AccessionMI0012263 (change log)
DescriptionIxodes scapularis miR-100 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention isc-mir-100
(6 sentences)

Stem-loop
   aagauc  --    -  c    ua         ucc          -cc  g 
5'       gg  agcg cc gccc  acccguaga   gaacuugugu   gc c
         ||  |||| || ||||  |||||||||   ||||||||||   || g
3'       cc  ucgc gg cggg  ugggcgucu   cuugaacacg   cg a
   --cuua  gu    u  u    uc         ccc          aaa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS978597: 252465-252565 [-]
intergenic
Database links

Mature sequence isc-miR-100

Accession MIMAT0012683
Sequence

21 - 

aacccguagauccgaacuugugu

 - 43

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).