Stem-loop sequence isc-mir-10

AccessionMI0012262 (change log)
DescriptionIxodes scapularis miR-10 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention isc-mir-10
(4 sentences)

Stem-loop
         cu -  -  g    u        ---    gc 
5' cuacau  a cc cu uaga ccgaauuu   gucu  a
   ||||||  | || || |||| ||||||||   ||||   
3' ggugug  u gg ga aucu ggcuuaaa   caga  a
         uu c  a  g    u        cau    ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence isc-miR-10

Accession MIMAT0012682
Sequence

8 - 

uacccuguagauccgaauuugu

 - 29

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).