Stem-loop sequence isc-mir-1

AccessionMI0012261 (change log)
DescriptionIxodes scapularis miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

1 open access papers mention isc-mir-1
(11 sentences)

Stem-loop
   -uc    ---    u a         c    uuc      g  uc c 
5'    cguu   cgga c ccgugcuuc uuac   ccauau ug  c c
      ||||   |||| | ||||||||| ||||   |||||| ||  | u
3'    gcag   gccu g gguaugaag aaug   gguaug gc  g c
   aca    gug    u a         a    uaa      -  ga a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS811420: 416289-416380 [+]
intergenic
Database links

Mature sequence isc-miR-1

Accession MIMAT0012681
Sequence

56 - 

uggaauguaaagaaguauggag

 - 77

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).