Stem-loop sequence isc-bantam

AccessionMI0012259 (change log)
DescriptionIxodes scapularis bantam stem-loop
Gene family MIPF0000153; bantam
Literature search

1 open access papers mention isc-bantam
(3 sentences)

Stem-loop
   gcc    -aaacgcca       cu                guc     gga 
5'    gaag         gacaaaa  gguuuucacaaugauc   cagau   c
      ||||         |||||||  ||||||||||||||||   |||||   c
3'    cuuc         uuguuuu  ucgaaaguguuacuag   gucug   u
   ---    gagacuuag       ag                --a     aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS612599: 38772-38872 [-]
intergenic
DS616556: 1178-1278 [-]
intergenic
Database links

Mature sequence isc-bantam

Accession MIMAT0012679
Sequence

61 - 

ugagaucauugugaaagcugauu

 - 83

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).