Stem-loop sequence dpu-mir-9

AccessionMI0012252 (change log)
DescriptionDaphnia pulex miR-9 stem-loop
Gene family MIPF0000014; mir-9
Literature search

2 open access papers mention dpu-mir-9
(9 sentences)

Stem-loop
   --ucgucau  c  u c    uu       u        g     g    a 
5'          gg gc g uuuu  cuuuggu aucuagcu uauga uguu g
            || || | ||||  ||||||| |||||||| ||||| ||||  
3'          cc cg c agaa  gaaacca uggaucga auacu gcag a
   gcuacuucu  c  u a    uu       u        a     -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (V1.0; GCA_000187875.1) Overlapping transcripts
GL732524.1: 1526193-1526293 [+]
intergenic
Database links

Mature sequence dpu-miR-9-5p

Accession MIMAT0012671
Previous IDsdpu-miR-9
Sequence

21 - 

ucuuugguuaucuagcuguauga

 - 43

Get sequence
Evidence not experimental

Mature sequence dpu-miR-79

Accession MIMAT0012668
Sequence

59 - 

auaaagcuagguuaccaaaguua

 - 81

Get sequence
Evidence experimental;

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).