Stem-loop sequence dpu-mir-34

AccessionMI0012244 (change log)
DescriptionDaphnia pulex miR-34 stem-loop
Gene family MIPF0000039; mir-34
Literature search

1 open access papers mention dpu-mir-34
(1 sentences)

Stem-loop
   gggcaaaa    -         u      g   u   c        aaauauu 
5'         gugu auugauggu ggcagu ugg uag ugguugug       u
           |||| ||||||||| |||||| ||| ||| ||||||||       a
3'         caca uagcuguca cuguca acc auc accgacac       c
   ------ag    g         c      a   u   -        cuaaguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (V1.0; GCA_000187875.1) Overlapping transcripts
GL732526.1: 1242035-1242135 [-]
intergenic
Clustered miRNAs
< 10kb from dpu-mir-34
dpu-mir-317GL732526.1: 1243945-1244045 [-]
dpu-mir-34GL732526.1: 1242035-1242135 [-]
Database links

Mature sequence dpu-miR-34

Accession MIMAT0012663
Sequence

22 - 

uggcagugugguuagcugguugug

 - 45

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).