Stem-loop sequence dpu-mir-33

AccessionMI0012243 (change log)
DescriptionDaphnia pulex miR-33 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   acacacu  -g    g    -ug        aguu       a  uugu   u 
5'        gg  ggua cccg   ugcauugu    gcauugc cg    caa u
          ||  |||| ||||   ||||||||    ||||||| ||    |||  
3'        cc  ccgu gggc   acgugacg    cguaacg gc    guu c
   ----ucg  aa    a    uca        gcuu       c  -uuu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (V1.0; GCA_000187875.1) Overlapping transcripts
GL732612.1: 265085-265185 [-]
intergenic
Database links

Mature sequence dpu-miR-33

Accession MIMAT0012662
Sequence

21 - 

gugcauuguaguugcauugcac

 - 42

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).